We have engineered the bacterial immune CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system as a platform for RNA-guided genes in bacteria, yeast, and human cells. This CRISPR interfering (CRISPRi) method works independently of host cellular machines, requiring only a nuclease-deactivated Cas9 (dCas9) protein and a customized single guide (sg) RNA designed with a ~20-basepair complementary region to any gene of interest. Co-expression of dCas9 and sgRNA can efficiently block transcription (in bacteria, ~ 300-fold repression) by interfering with transcriptional elongation, RNA polymerase binding, or transcription factor binding.

The binding specificity is determined jointly by a 20-bp matching region on the sgRNA and a short DNA motif (protospacer adjacent motif, or PAM, sequence: NRG, R = G or A) juxtaposed to the DNA complementary region. The uniqueness of CRISPRi, as compared to several recently published works on using the wild-type CRISPR system for genome editing, is that the nuclease-deficient dCas9 mutant could silence transcription of the target gene expression without genetically altering the target sequence. Thus, CRISPRi is a system that can regulate a genome instead of modifying it.

More details about the CRISPRi technology can be found on wikipedia.

The first plasmid (pdCas9_bacteria) contains an anhydrotetracycline (aTc)-inducible dcas9 gene on a p15A vector with chloramphenicol resistance. The second plasmid (pgRNA_bacteria) contains a constitutive sgRNA expression cassette on a ColE1 vector with ampicillin resistance, wherein N20 can be custom designed to target arbitrary sequences in the genome. Co-expression of both plasmids in bacteria could cause about 300-fold repression on targeted genes.

The dCas9 fusion CEN/ARS plasmids contain a human codon optimized dCas9 fused with two C-terminal SV40 nuclear localization signal sequences and an Mxi1 repressive domain.  The sgRNA CEN/ARS plasmids contain a SNR52 promoter, sgRNA, and SUP4 terminator 3’ flanking sequence

The dCas9 fusion plasmids contain a human codon optimized dcas9 gene that is fused to different effector domains, under the control of either a spleen focus-forming virus (SFFV) or a murine Stem cell retrovirus LTR promoter. The sgRNA plasmids contain a murine U6 promoter controlled sgRNA cassette, wherein the GN19 can be custom designed to target sequences in the genome. The sgRNA plasmid also contains a CMV-puro-t2A-mCherry expression cassette, for selection or fluorescent gating of transiently transfected cells.

We have obtained an optimized sgRNA design could dramatically enhance the efficiency of using S. pyogenes Cas9 for genome editing, regulation (3-10 fold increase for activation and repression), and imaging. The new sgRNA sequence is the following:

5'- GN19GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAG TGGCACCGAGTCGGTGCTTTTTTT-3’

Where the GN19 (N = A/T/C/G) is the basepairing sequence to the target DNA; the modified basepairs are underlined.

We have created a set of chimericscaffold RNAs (scRNAs) by fusing the CRISPR sgRNA to protein-binding RNA aptamers (RNA structures that can specifically bind to ligands such as small molecules or peptides). The scRNAs allow encoding the DNA location information and mode of regulation (activation, repression or other instructions) into one single RNA that is small (<150 nucleotides), modular, and reprogrammable.

We have shown that the scRNAs in combination with orthorgonal RNA-binding proteins such as bacteriophage proteins, MS2, PP7, and com enable multiplexed transcription activation and repression in single cells. This offers a powerful approach for directing metabolic pathways and reprogram complex mammalian cells.