Bio

Academic Appointments


Research & Scholarship

Current Research and Scholarly Interests


SMRL's current research is on the development of methods that will extend the usefulness of NMR to the study of the structure and dynamics of larger proteins (MW>15,000), protein-ligand, protein-protein and protein-nucleic acid interactions. NMR is rapidly becoming a popular method to study macromolecular dynamics and structure, since NMR spectroscopy can assist in the analysis of samples in solution where the molecules can move and change, as opposed to crystallographic studies of molecules, where the structure can be clearly seen, but only when frozen for a moment in time so that the dynamics of movement and structural change over time cannot be as easily observed.

Specific projects currently underway at SMRL include studies of the mechanism of action of trp-repressor, the trp-ODNA complex and the trp-mtr DNA complex, NMR studies of ankyrin-domain proteins, the structure determination of the TyrR protein of Hemophilus influenzae, and a theoretical analysis of slow motions in proteins.

Publications

Journal Articles


  • Beginnings and early history of the International Conferences on Magnetic Resonance in Biological Systems: development of the basic ideas in the field. Journal of magnetic resonance Jardetzky, O. 2010; 206 (1): 2-8

    Abstract

    The early history of the principal meeting in the field of biological NMR spectroscopy, the International Conference on Magnetic Resonance in Biological Systems (ICMRBS), is presented from the perspective of one of the founders.

    View details for DOI 10.1016/j.jmr.2010.07.005

    View details for PubMedID 20727503

  • fMRI in Brain Research in Its Historical Context AMERICAN JOURNAL OF BIOETHICS Jardetzky, O. 2008; 8 (9): 43-45

    View details for DOI 10.1080/15265160802334482

    View details for Web of Science ID 000259996700017

    View details for PubMedID 18853385

  • Predicting N-15 chemical shifts in proteins using the preceding residue-specific individual shielding surfaces from phi, psi(i-1), and chi(1) torsion angles JOURNAL OF BIOMOLECULAR NMR Wang, Y. J., Jardetzky, O. 2004; 28 (4): 327-340

    Abstract

    Empirical shielding surfaces are most commonly used to predict chemical shifts in proteins from known backbone torsion angles, phi and psi. However, the prediction of (15)N chemical shifts using this technique is significantly poorer, compared to that for the other nuclei such as (1)H(alpha), (13)C(alpha), and (13)C(beta). In this study, we investigated the effects from the preceding residue and the side-chain geometry, chi(1), on (15)N chemical shifts by statistical methods. For an amino acid sequence XY, the (15)N chemical shift of Y is expressed as a function of the amino acid types of X and Y, as well as the backbone torsion angles, phi and psi(i-1). Accordingly, 380 empirical 'Preceding Residue Specific Individual (PRSI)' (15)N chemical shift shielding surfaces, representing all the combinations of X and Y (except for Y=Pro), were built and used to predict (15)N chemical shift from phi and psi(i-1). We further investigated the chi(1) effects, which were found to account for differences in (15)N chemical shifts by approximately 5 ppm for amino acids Val, Ile, Thr, Phe, His, Tyr, and Trp. Taking the chi(1) effects into account, the chi(1)-calibrated PRSI shielding surfaces (XPRSI) were built and used to predict (15)N chemical shifts for these amino acids. We demonstrated that (15)N chemical shift predictions are significantly improved by incorporating the preceding residue and chi(1) effects. The present PRSI and XPRSI shielding surfaces were extensively compared with three recently published programs, SHIFTX (Neal et al., 2003), SHIFTS (Xu and Case, 2001 and 2002), and PROSHIFT (Meiler, 2003) on a set of ten randomly selected proteins. A set of Java programs using XPRSI shielding surfaces to predict (15)N chemical shifts in proteins were developed and are freely available for academic users at http://www.pronmr.com or by sending email to one of the authors Yunjun Wang (yunjunwang@yahoo.com).

    View details for Web of Science ID 000188853300002

    View details for PubMedID 14872125

  • Surface plasmon resonance studies of wild-type and AV77 tryptophan repressor resolve ambiguities in super-repressor activity PROTEIN SCIENCE Finucane, M. D., Jardetzky, O. 2003; 12 (8): 1613-1620

    Abstract

    The interactions of wild-type (WT) and AV77 tryptophan repressor (TR) with several operators have been studied using surface plasmon resonance. The use of this real-time method has been able to settle several outstanding issues in the field, in a way that has heretofore not been possible. We resolve the issue of the super-repressor status of the AV77 aporepressor and find that in contrast to early studies, which found no significant difference in the binding constants in vitro to those of the WT, that there is indeed a clear difference in the binding constant that can simply account for the phenotype. Accordingly, there is no need for alternative proposals invoking complex equilibria with in vivo components not found in the in vitro experiments. In addition, we find that the AV77 holorepressor-DNA complex is much more stable than the equivalent WT complex, which has not been apparent from either in vitro or equilibrium binding experiments.

    View details for DOI 10.1110/ps.0305703

    View details for Web of Science ID 000184403100004

    View details for PubMedID 12876311

  • Investigation of the neighboring residue effects on protein chemical shifts JOURNAL OF THE AMERICAN CHEMICAL SOCIETY Wang, Y. J., Jardetzky, O. 2002; 124 (47): 14075-14084

    Abstract

    In this study, we report nearest neighbor residue effects statistically determined from a chemical shift database. For an amino acid sequence XYZ, we define two correction factors, Delta((X)Y)n,s and Delta(Y(Z))n,s, representing the effects on Y's chemical shifts from the preceding residue (X) and the following residue (Z), respectively, where X, Y, and Z are any of the 20 naturally occurring amino acids, n stands for (1)H(N), (15)N, (1)H(alpha), (13)C(alpha), (13)C(beta), and (13)C' nuclei, and s represents the three secondary structural types beta-strand, random coil, and alpha-helix. A total of approximately 14400 Delta((X)Y)n,s and Delta(Y(Z))n,s, representing nearly all combinations of X, Y, Z, n, and s, have been quantitatively determined. Our approach overcomes the limits of earlier experimental methods using short model peptides, and the resulting correction factors have important applications such as chemical shift prediction for the folded proteins. More importantly, we have found, for the first time, a linear correlation between the Delta((X)Y)n,s (n = (15)N) and the (13)C(alpha) chemical shifts of the preceding residue X. Since (13)C(alpha) chemical shifts of the 20 amino acids, which span a wide range of 40-70 ppm, are largely dominated by one property, the electron density of the side chain, the correlation indicates that the same property is responsible for the effect on the following residue. The influence of the secondary structure on both the chemical shifts and the nearest neighbor residue effect are also investigated.

    View details for DOI 10.1021/ja026811f

    View details for Web of Science ID 000179404200035

    View details for PubMedID 12440906

  • Probability-based protein secondary structure identification using combined NMR chemical-shift data PROTEIN SCIENCE Wang, Y. J., Jardetzky, O. 2002; 11 (4): 852-861

    Abstract

    For a long time, NMR chemical shifts have been used to identify protein secondary structures. Currently, this is accomplished through comparing the observed (1)H(alpha), (13)C(alpha), (13)C(beta), or (13)C' chemical shifts with the random coil values. Here, we present a new protocol, which is based on the joint probability of each of the three secondary structural types (beta-strand, alpha-helix, and random coil) derived from chemical-shift data, to identify the secondary structure. In combination with empirical smooth filters/functions, this protocol shows significant improvements in the accuracy and the confidence of identification. Updated chemical-shift statistics are reported, on the basis of which the reliability of using chemical shift to identify protein secondary structure is evaluated for each nucleus. The reliability varies greatly among the 20 amino acids, but, on average, is in the order of: (13)C(alpha)>(13)C'>(1)H(alpha)>(13)C(beta)>(15)N>(1)H(N) to distinguish an alpha-helix from a random coil; and (1)H(alpha)>(13)C(beta) >(1)H(N) approximately (13)C(alpha) approximately (13)C' approximately (15)N for a beta-strand from a random coil. Amide (15)N and (1)H(N) chemical shifts, which are generally excluded from the application, in fact, were found to be helpful in distinguishing a beta-strand from a random coil. In addition, the chemical-shift statistical data are compared with those reported previously, and the results are discussed. A JAVA User Interface program has been developed to make the entire procedure fully automated and is available via http://ccsr3150-p3.stanford.edu.

    View details for DOI 10.1110/ps.3180102

    View details for Web of Science ID 000174594200011

    View details for PubMedID 11910028

  • Solution structure of the DNA-binding domain of the TyrR protein of Haemophilus influenzae PROTEIN SCIENCE Wang, Y. J., Zhao, S., Somerville, R. L., Jardetzky, O. 2001; 10 (3): 592-598

    Abstract

    The TyrR protein of Haemophilus influenzae is a 36-kD transcription factor whose major function is to control the expression of genes important in the biosynthesis and transport of aromatic amino acids. Using (1)H and (15)N NMR spectroscopy, we have determined the 3D solution structure of the TyrR C-terminal DNA-binding domain (DBD) containing residues from 258 to 318 (TyrR[258-318]). The NMR results show that this segment of TyrR consists of a potential hinge helix at its N terminus (residues 263-270) as well as three well-defined alpha-helices extending from residues 277-289 (HR-2), 293-300 (HR-1), and 304-314 (HR). Helix HR-1 and HR fold in a typical helix-turn-helix (HTH) motif. The three helices and the hinge helix are tightly bound together by hydrophobic interaction and hydrogen bonds. Several hydrophilic residues whose side chains may directly interact with DNA are identified. A hydrophobic patch that may be part of the interaction surface between the domains of TyrR protein is also observed. Comparisons with the structures of other HTH DNA-binding proteins reveal that in terms of the spatial orientation of the three helices, this protein most closely resembles the cap family.

    View details for Web of Science ID 000167926100013

    View details for PubMedID 11344327

  • Flexibility of DNA binding domain of trp repressor required for recognition of different operator sequences PROTEIN SCIENCE Gryk, M. R., Jardetzky, O., Klig, L. S., Yanofsky, C. 1996; 5 (6): 1195-1197

    Abstract

    Trp repressor (25 kDa) is a regulatory protein that controls transcription initiation in the tryptophan biosynthetic operon and at least four other operons in Escherichia coli. An alanine to valine mutation (AV77) in the DNA binding domain is known to increase repressor activity at the trp operator in vivo, but not in vitro. We report here the amide proton exchange rates for the DNA-binding domains of both the wild-type and AV77 proteins. We find that the alanine to valine change stabilizes the flexible DNA-binding domain of the repressor. We present in vivo data showing that, although the AV77 repressor is more inhibitory at the trp operator than the wild-type repressor, it does not have increased activity at the aroH or trpR operator; repression at the aroH operator is, in fact, reduced. Our results suggest that the flexibility exhibited by the wild-type repressor allows a broader range of repressor/DNA interactions, whereas the increased rigidity resulting from the AV77 change limits the repressor's effectiveness at some operators.

    View details for Web of Science ID A1996UP61700024

    View details for PubMedID 8762153

  • The pH dependence of hydrogen-deuterium exchange in trp repressor: The exchange rate of amide protons in proteins reflects tertiary interactions, not only secondary structure PROTEIN SCIENCE Finucane, M. D., Jardetzky, O. 1996; 5 (4): 653-662

    Abstract

    The pH dependence of amide proton exchange rates have been measured for trp-repressor. One class of protons exchanges too fast to be measured in these experiments. Among the protons that have measurable hydrogen-deuterium exchange rates, two additional classes may be distinguished. The second class of protons are in elements of secondary structure that are mostly on the surface of the protein, and exchange linearly with increasing base concentration (log kex versus pH). The third class of amide protons is characterized by much higher protection against exchange at higher pH. These protons are located in the core of the protein, in helices B and C. The exchange rate in the core region does not increase linearly with pH, but rather goes through a minimum around pH 6. The mechanism of exchange for the slowly exchanging core protons is interpreted in terms of the two-process model of Hilton and Woodward (1979, Biochemistry 18:5834-5841), i.e., exchange through both a local mechanism that does not require unfolding of the protein, and a mechanism involving global unfolding of the protein. The increase in exchange rates at low pH is attributed to a partial unfolding of the repressor. It is concluded that the formation of secondary structure alone is insufficient to account for the high protection factors seen in the core of native proteins at higher pH, and that tertiary interactions are essential to stabilize the structure.

    View details for Web of Science ID A1996UD30400009

    View details for PubMedID 8845754

  • AV77 hinge mutation stabilizes the helix-turn-helix domain of trp repressor JOURNAL OF MOLECULAR BIOLOGY Gryk, M. R., Jardetzky, O. 1996; 255 (1): 204-214

    Abstract

    The structure and dynamics of the AV77 holorepressor have been studied using nuclear Overhauser enhancement spectroscopy (NOESY). By comparing NOE crosspeaks as well as proton chemical shifts, we find no evidence for any substantial difference between the wild-type and AV77 repressor structures. In addition, however, we have measured the rapid amide proton exchange rates for the DNA binding region of the apo and holo forms of the mutant and wild-type repressors using proton relaxation and saturation transfer techniques. We find that the hydrogen bonded amide protons in the DNA binding regions are stabilized for the most part by at least an order of magnitude for both forms of the mutant repressors. This is compared to a three to five fold stabilization of the holo wild-type molecule over the apo form. As the AV77 mutant is observed to be a superrepressor in vivo, we ascribe the enhanced activity of this mutant to a decrease in the instability of the DNA binding domain. We therefore suggest that the inherent instability of this domain in the wild-type molecule is needed for efficient regulation of the repressor by its corepressor, L-tryptophan, and in addition may allow for recognition of a broad range of operators.

    View details for Web of Science ID A1996TQ68600017

    View details for PubMedID 8568867

  • Protein dynamics and conformational transitions in allosteric proteins PROGRESS IN BIOPHYSICS & MOLECULAR BIOLOGY Jardetzky, O. 1996; 65 (3): 171-?

    View details for Web of Science ID A1996WL49800001

    View details for PubMedID 9062432

  • Amide proton exchange rates in c-myb DNA-binding domain. Quart. Magn. Reson. Biol. Med. Zheng Z, Brockel C, Ganter B, Lipsick J, Sasaki M, Ogata K, Nishimura Y, Jardetzky O 1996; 3: 33-45
  • MECHANISM OF HYDROGEN-DEUTERIUM EXCHANGE IN TRP REPRESSOR STUDIED BY H-1-N-15 NMR JOURNAL OF MOLECULAR BIOLOGY Finucane, M. D., Jardetzky, O. 1995; 253 (4): 576-589

    Abstract

    Amide proton exchange rates have been measured for fast-exchanging amides in trp aporepressor, and compared with the rates measured in the holorepressor. The results indicate that the presence of the ligand stabilizes all of the amide protons in the molecule against exchange, not just those whose access to solvent it directly hinders. This global hindering of the exchange process by tryptophan implies that there is a non-random element in the transmission mechanism, so that damping of the exchange in one part of the molecule also damps exchange in another region. This damping at a distance is not associated with any measurable changes in the intervening average secondary structure. This suggests the existence of a concerted dynamic process in the protein backbone that is modulated by ligand binding and in turn affects the observed backbone proton exchange.

    View details for Web of Science ID A1995TD03000005

    View details for PubMedID 7473735

  • DYNAMICS OF TRYPTOPHAN BINDING TO ESCHERICHIA-COLI TRP REPRESSOR WILD-TYPE AND AV77 MUTANT - AN NMR-STUDY BIOCHEMISTRY SCHMITT, T. H., Zheng, Z. W., Jardetzky, O. 1995; 34 (40): 13183-13189

    Abstract

    Binding of L-tryptophan to Escherichia coli trp repressor wild type (WT) and AV77 mutant was studied by 1H NMR spectroscopy. Ligand binding to the proteins resulted in changes in line widths and chemical shifts of ligand resonances, but no changes in the coupling constant were observed. Line width and chemical shift changes of the H4 L-tryptophan proton were monitored as a function of temperature and ligand and protein concentrations. For the WT repressor, the H4 proton displays slow exchange at low temperatures (20-35 degrees C), while fast exchange occurs in the range from 45 to 65 degrees C. From 35 to 40 degrees C, the range of intermediate exchange, lines are broadened beyond detection. For the AV77 mutant, the intermediate and fast exchange regions are shifted at least 5 degrees C to higher temperatures. Line shapes of L-tryptophan H4 proton resonances were simulated using a general expression based on McConnell's modified Bloch equations for a two-site exchange. From the simulations, an exchange frequency (upsilon exch) of about 3000 Hz was obtained at 45 degrees C for WT and about 1000 Hz for AV77 mutant. The activation energy for the process is 32.7 kcal K-1 mol-1 for the WT and 29.1 kcal K-1 mol-1 for AV77. At 45 degrees C, the dissociation and association rate constants (k-1 and K+1, respectively) were calculated to be 2.0 x 10(3) s-1 and 9.9 x 10(6) M-1 s-1, for the WT.(ABSTRACT TRUNCATED AT 250 WORDS)

    View details for Web of Science ID A1995RZ75200033

    View details for PubMedID 7548081

  • INVESTIGATION OF PROTEIN AMIDE-PROTON EXCHANGE BY H-1 LONGITUDINAL SPIN RELAXATION JOURNAL OF MAGNETIC RESONANCE SERIES B Zheng, Z. W., Gryk, M. R., Finucane, M. D., Jardetzky, O. 1995; 108 (3): 220-234

    Abstract

    The general theory of the Linderstrøm-Lang model, which, in simplified form, is widely used for the interpretation of NMR data on backbone-proton exchange in proteins, is systematically discussed. An experimental protocol for testing the applicability of the customary simplifications is described and experimental data which require the application of the general, rather than of the simplified, theory are presented. The appearance of pH-dependent biexponential magnetization recovery for any amide group in a protein is an unequivocal indication that the conventional simplified versions of the model do not apply.

    View details for Web of Science ID A1995RU65400003

    View details for PubMedID 7670756

  • BACKBONE DYNAMICS OF TRP REPRESSOR STUDIED BY N-15 NMR RELAXATION BIOCHEMISTRY Zheng, Z. W., Czaplicki, J., Jardetzky, O. 1995; 34 (15): 5212-5223

    Abstract

    Backbone dynamics of trp repressor, a 25 kDa DNA binding protein, have been studied using 15N relaxation data measured by proton-detected two-dimensional 1H-15N NMR spectroscopy. 15N spin-lattice relaxation time (T1), spin-spin relaxation time (T2), and heteronuclear NOEs were determined for all visible backbone amide 15N nuclei. Monte Carlo simulations of the amplitudes of backbone motions led to the conclusion that a wobbling in a cone model with consideration of the anisotropic reorientation of the molecule was appropriate to describe the underlying motions, allowing us to derive the semiangle of the cone (alpha) and the effective correlation time for internal motions (tau e) for each N-H bond vector. The final optimized rotational diffusion coefficients parallel (D parallel) and perpendicular (D perpendicular) to the unique axis of the molecule were found to be 1.48 +/- 0.06 x 10(7) and 1.15 +/- 0.05 x 10(7) s-1, respectively. The average semiangle of the cone (alpha) describing the amplitude of NH vector motions on the picosecond time scale was found to be 20.9 +/- 5.7 degrees. Large amplitude motions on the picosecond time scale are found at both the N and C termini but are restricted in both the hydrophobic core and DNA-binding regions.

    View details for Web of Science ID A1995QU26000035

    View details for PubMedID 7711041

  • SOLUTION DYNAMICS OF THE TRP REPRESSOR - A STUDY OF AMIDE PROTON-EXCHANGE BY T-1 RELAXATION JOURNAL OF MOLECULAR BIOLOGY Gryk, M. R., Finucane, M. D., Zheng, Z. W., Jardetzky, O. 1995; 246 (5): 618-627

    Abstract

    The amide proton exchange rates of Escherichia coli trp repressor have been measured through their effects on the longitudinal relaxation rates of the amide protons. Three types of exchange regimes have been observed: (1) slow exchange (on a minute/hour time-scale), measurable by isotope exchange, but not by relaxation techniques in the core of the molecule; (2) relatively rapid exchange, with the rates on a T1 relaxation time-scale (seconds) in the DNA-binding region and (3) very fast exchange at the N and C termini. The results have been analyzed in terms of the two-site exchange model originally proposed by Linderstrøm-Lang, and of a three-site extension of the model. The values of the intrinsic exchange rates calculated using the two-state model agree with the values expected from the studies of Englander and co-workers for the very fast case of the chain terminals, but disagree with the literature values by two orders of magnitude in the intermediate case found in the DNA-binding region. The implication of these findings is that the "open" state of the two-state model in the DNA-binding region is not completely open and has an intrinsic exchange rate different from that of a random coil peptide. Alternatively, if the literature values of the intrinsic exchange rates are assumed to apply to the open states in all parts of the repressor molecule, two "closed" helical states have to be postulated, in slow exchange with each other, with only one of them in rapid exchange with the open state and hence with the solvent. Kinetically, the two models are indistinguishable.

    View details for Web of Science ID A1995QL57600007

    View details for PubMedID 7877180

  • AN ASSESSMENT OF THE PRECISION AND ACCURACY OF PROTEIN STRUCTURES DETERMINED BY NMR - DEPENDENCE ON DISTANCE ERRORS JOURNAL OF MOLECULAR BIOLOGY Zhao, D. Q., Jardetzky, O. 1994; 239 (5): 601-607

    Abstract

    We tested the dependence of the accuracy and precision of calculated NMR structures on the errors of the distance constraints using sequential simulated annealing and found that: (1) the accuracy of the family of structures depends mainly on the quality of the data, but is no better than about 1 A even if the errors in distance constraints are smaller than +/- 1 A. (2) The precision of the calculated structures, on the other hand, is nearly insensitive to the quality of the data. With present methods, the accuracy of NMR structures is at best of the order of 1 to 2 A, although a precision of 0.4 to 0.7 A is readily attainable. Comparisons with recent studies of this problem also brought out the importance of distinguishing between correct and incorrect definitions of accuracy when reporting numerical estimates. Using an incorrect definition of the term accuracy can lead to an artificially favorable estimate of its numerical value.

    View details for Web of Science ID A1994NT74000001

    View details for PubMedID 8014985

  • THE SOLUTION STRUCTURES OF THE TRP REPRESSOR-OPERATOR DNA COMPLEX JOURNAL OF MOLECULAR BIOLOGY Zhang, H., Zhao, D. Q., Revington, M., Lee, W. T., Jia, X., Arrowsmith, C., Jardetzky, O. 1994; 238 (4): 592-614

    Abstract

    The solution structures of the complex between Escherichia coli trp holorepressor and a 20 base-pair consensus operator DNA were determined. The majority of proton chemical shifts of the trp holorepressor and operator DNA were assigned from homonuclear 2D NOESY spectra of selectively deuterated analog-operator DNA complexes and the 3D NOESY-HMQC spectrum of a uniformly 15N-labeled repressor-operator DNA complex. The structures were calculated using restrained molecular dynamics and sequential simulated annealing with 4086 NOE and other experimental constraints. The root-mean-squared deviation (RMSD) among the calculated structures and their mean is 0.9(+/- 0.3)A for the repressor backbone, 1.1(+/- 0.5)A for the DNA backbone, and 1.3(+/- 0.3)A for all heavy atoms. The DNA is deformed to a significant extent from the standard B DNA structure to fit the helix-turn-helix (HTH) segment of the repressor (helices D and E) into its major grooves. Little change is found in the ABCF core of the repressor on complexation in comparison to the free repressor, but changes in the cofactor L-tryptophan binding pocket and the HTH segment are observed. The N-terminal residues (2 to 17) are found to be disordered and do not form stable interactions with DNA. Direct H-bonding to the bases of the operator DNA is consistent with all of our observed NOE constraints. Hydrogen bonds from NH eta 1 and NH eta 2 of Arg69 to O-6 and N-7 of G2 are compatible with the solution structure, as they are with the crystal structure. Other direct H-bonds from Lys72, Ala80, Ile79, Thr83 and Arg84 to base-pair functional groups can also be formed in our solution structures.

    View details for Web of Science ID A1994NM06600010

    View details for PubMedID 8176748

  • High-resolution proton NMR studies of lymphocyte extracts. ImmunoMethods Sze, D. Y., Jardetzky, O. 1994; 4 (2): 113-126

    Abstract

    Anatomic imaging is now a well-developed application of magnetic resonance. Greater capabilities for physiologic characterization should become possible by concomitant application of spectroscopic methods. High-resolution in vitro spectroscopy must first provide a framework upon which in vivo and diagnostic interpretation may be based. Biochemical profiles consisting of quantitation of extracted aqueous metabolites and lipids of particular cells or organs establish an in vitro glossary for what may be found in the intact cell or living subject. A large variety of amino acids, intermediary metabolites, membrane precursors, and nucleotides are detectable in extracts of human peripheral blood lymphocytes, and significant changes in intracellular concentrations have been monitored after lectin-induced activation. Corresponding changes in lipid profile have also been noted. An increasing variety of other cells and tissues are being similarly characterized. Despite its limitations, NMR analysis possesses the unique prospect of providing a noninvasive and nondestructive source of biochemical information.

    View details for PubMedID 8069531

  • PROTEIN DYNAMICS FEBS LETTERS Jardetzky, O., Lefevre, J. F. 1994; 338 (3): 246-250

    Abstract

    Modern NMR has revitalized the study of protein dynamics. Multidimensional spectra and the heteronuclear spectroscopy allow a substantial gain in resolution. Dynamics can be analyzed at individual sites and data on segmental and sequence-dependent flexibility are accumulating. This review summarizes the wide variety of NMR approaches for observing internal motions, including the folding processes, and the attempts to correlate dynamics to the biological activity of proteins. The implications of mobility on structure determination by NMR is also discussed.

    View details for Web of Science ID A1994MW15500002

    View details for PubMedID 8307188

  • REFINED SOLUTION STRUCTURES OF THE ESCHERICHIA-COLI TRP HOLOREPRESSOR AND APOREPRESSOR JOURNAL OF MOLECULAR BIOLOGY Zhao, D., Arrowsmith, C. H., Jia, X., Jardetzky, O. 1993; 229 (3): 735-746

    Abstract

    The solution structures of the trp-repressor from Escherichia coli in both the liganded (holo-) and unliganded (apo-) form, have been refined by restrained molecular dynamics with simulated annealing using the program XPLOR and additional experimental constraints. The ensemble of refined holorepressor structures have a root-mean-square deviation (r.m.s.d.) of 0.8 A relative to the average structure for the backbone of the dimer core (helices A, B, C, A', B', C') and 2.5 A for the helix-turn-helix DNA-binding domain (helices D and E). The corresponding values for the aporepressor are 0.9 A for the backbone of the ABC-dimer core and 3.2 A for the DE helix-turn-helix. The r.m.s.d. of the average structures from the corresponding crystal structures are 2.3 A for the holorepressor ABC core and 4.2 A for its DE region; 2.3 A for the aporepressor core and 5.5 A for its DE region. The relative disorder of the DNA-binding domain is reflected in a number of experimental parameters including substantially more rapid backbone proton exchange rates, exchange-limited relaxation times and crystallographic B-factors. The stabilizing effect of the L-Trp ligand is evident in these measurements, as it is in the higher precision of the holorepressor structure.

    View details for Web of Science ID A1993KM69800015

    View details for PubMedID 8433368

  • A SYSTEMATIC COMPARISON OF 3 STRUCTURE DETERMINATION METHODS FROM NMR DATA - DEPENDENCE UPON QUALITY AND QUANTITY OF DATA JOURNAL OF BIOMOLECULAR NMR Liu, Y. J., Zhao, D. Q., Altman, R., Jardetzky, O. 1992; 2 (4): 373-388

    Abstract

    We have systematically examined how the quality of NMR protein structures depends on (1) the number of NOE distance constraints, (2) their assumed precision, (3) the method of structure calculation and (4) the size of the protein. The test sets of distance constraints have been derived from the crystal structures of crambin (5 kDa) and staphylococcal nuclease (17 kDa). Three methods of structure calculation have been compared: Distance Geometry (DGEOM), Restrained Molecular Dynamics (XPLOR) and the Double Iterated Kalman Filter (DIKF). All three methods can reproduce the general features of the starting structure under all conditions tested. In many instances the apparent precision of the calculated structure (as measured by the RMS dispersion from the average) is greater than its accuracy (as measured by the RMS deviation of the average structure from the starting crystal structure). The global RMS deviations from the reference structures decrease exponentially as the number of constraints is increased, and after using about 30% of all potential constraints, the errors asymptotically approach a limiting value. Increasing the assumed precision of the constraints has the same qualitative effect as increasing the number of constraints. For comparable numbers of constraints/residue, the precision of the calculated structure is less for the larger than for the smaller protein, regardless of the method of calculation. The accuracy of the average structure calculated by Restrained Molecular Dynamics is greater than that of structures obtained by purely geometric methods (DGEOM and DIKF).

    View details for Web of Science ID A1992JF96900006

    View details for PubMedID 1511237

  • THE EFFECT OF SELECTIVE DEUTERATION ON MAGNETIZATION TRANSFER IN LARGER PROTEINS JOURNAL OF BIOMOLECULAR NMR Pachter, R., Arrowsmith, C. H., Jardetzky, O. 1992; 2 (2): 183-194

    Abstract

    The effects of selective deuteration on calculated NOESY intensities have been analyzed for the structure of the E. coli trp aporepressor, a 25 kDa protein. It is shown that selectively deuterated trp aporepressor proteins display larger calculated NOESY intensities than those for the same interproton distances in the natural abundance protein. The relatively larger magnetization transfer is demonstrated by a comparison of the NOE build-up curves for specific proton pairs, and for the calculated NOE intensities of short-range NOEs to backbone amide protons. This increase in intensity is especially pronounced for the NHi-NHi+1 cross peaks in the alpha-helical regions, and particularly for amide protons of two sequential deuterated residues. The effect is shown to be further intensified for longer mixing times. It is also shown that in all cases, each amide proton exhibits stronger NOEs to its own side chain, with an enhanced effect for deuterated derivatives. This theoretical analysis demonstrates that an evaluation of the relative NOE intensities for different selectively deuterated analogs may be an important tool in assigning NMR spectra of large proteins. These results also serve as a guide for the interpretation of NOEs in terms of distances for structure calculations based on data using selectively deuterated proteins.

    View details for Web of Science ID A1992HL58100006

    View details for PubMedID 1422151

  • THE SOLUTION STRUCTURES OF ESCHERICHIA-COLI-TRP REPRESSOR AND TRP APOREPRESSOR AT AN INTERMEDIATE RESOLUTION EUROPEAN JOURNAL OF BIOCHEMISTRY Arrowsmith, C., Pachter, R., Altman, R., Jardetzky, O. 1991; 202 (1): 53-66

    Abstract

    We have determined the solution structures and examined the dynamics of the Escherichia coli trp repressor (a 25-kDa dimer), with and without the co-repressor L-tryptophan, from NMR data. This is the largest protein structure thus far determined by NMR. To obtain a set of data sufficient for a structure determination it was essential to resort to isotopic spectral editing. Line broadening observed in this molecular mass range precludes for the most part the measurement of coupling constants and stereospecific assignments, with the inevitable result that the attainable resolution of the final structure will be somewhat lower than the resolution reported for smaller proteins and peptides. Nevertheless the general topology of the protein can be deduced from the subsets of NOEs defining the secondary and tertiary structure, providing a basis for further refinement using the full set of NOEs and energy minimization. We report here (a) an intermediate resolution structure that can be deduced from NMR data, covalent, angular and van-der-Waals constraints only, without resort to detailed energy calculations, and (b) the limits of uncertainty within which this structure is valid. An examination of these structures combined with backbone amide exchange data shows that even at this resolution three important conclusions can be drawn: (a) the protein structure changes upon binding tryptophan; (b) the putative DNA binding region is much more flexible than the core of the molecule, with backbone amide proton exchange rates 1000 times faster than in the core; (c) the binding of tryptophan stabilizes the repressor molecule, which is reflected in both the appearance of additional NOEs, and in the slowing of backbone proton exchange rates by factors of 3-10. Sequence-specific 1H-NMR assignments and the secondary structure of the holopressor (L-tryptophan-bound form) have been reported previously [C. H. Arrowsmith, R. Pachter, R. B. Altman, S. B. Iyer & O. Jardetzky (1990) Biochemistry 29, 6332-6341]. Those for the trp aporepressor (L-tryptophan-free form), made using the same methods and conditions as described in the cited paper, are reported here. The secondary structure of the aporepressor was calculated from sequential and medium-range NOEs and is the same as reported for the holorepressor except that helix E is shorter. The tertiary solution structures for both forms of the repressor were calculated from long-range NOE data.(ABSTRACT TRUNCATED AT 400 WORDS)

    View details for Web of Science ID A1991GP84100006

    View details for PubMedID 1935980

  • Segmental differences in the stability of the trp-repressor peptide backbone. Journal of biomolecular NMR Czaplicki, J., Arrowsmith, C., Jardetzky, O. 1991; 1 (4): 349-361

    Abstract

    Exchange lifetimes of amide protons in trp-repressor with and without the corepressor, L-tryptophan, were studied by heteronuclear 2D NMR spectroscopy. The amide proton exchange times revealed pronounced differences in the stability of different regions of the trp-repressor. The dimeric core of the molecule is relatively compact and homogeneous in terms of the measured parameters in both apo- and holorepressors. On the other hand the DNA-binding region appears less stable and more susceptible to the exchange of its backbone protons with the solvent. The NMR findings reported here are consistent with and amplify information on the stability of the trp-repressor obtained by other methods.

    View details for PubMedID 1841704

  • A STUDY OF NEPHROTOXIN-INDUCED ACUTE TUBULAR-NECROSIS WITH P-31 MAGNETIC-RESONANCE SPECTROSCOPY MAGNETIC RESONANCE IN MEDICINE Schutz, T., GONZALEZMENDEZ, R., Nabseth, D. C., Tune, B. M., Jardetzky, O., Stevenson, D. K. 1991; 18 (1): 159-168

    Abstract

    Phosphorus magnetic resonance spectroscopy (31P MRS) was used to obtain in vivo spectra from rat kidneys undergoing acute tubular necrosis induced by a nephrotoxic dose of cephaloridine (CLD). Spectra were obtained 0, 24, and 48 h after injection of CLD (experimental group, n = 6) or saline vehicle (control group, n = 6). The nephrotoxicity of CLD was demonstrated by severely increased serum creatinine levels and the development of extensive proximal tubular necrosis in the CLD-injected rats, and the lack of such changes in the controls. 31P MRS showed an increase in the inorganic phosphate region signal (Pi, p = 0.004) and a decrease in the phosphodiester region signal (PDE, p = 0.01) in the experimental group by 48 h, whereas these parameters did not vary significantly in the control group during the experiment. Significant correlations were found between serum creatinine and the same two 31P MRS parameters. In summary, rat kidneys which have developed severe CLD-induced proximal tubular necrosis exhibit changes in the 31P spectrum 48 h after administration of the drug. The causes of these changes were not determined.

    View details for Web of Science ID A1991EZ54700015

    View details for PubMedID 2062227

  • CHARACTERIZATION OF LIPID-COMPOSITION IN STIMULATED HUMAN-LYMPHOCYTES BY H-1-NMR BIOCHIMICA ET BIOPHYSICA ACTA Sze, D. Y., Jardetzky, O. 1990; 1054 (2): 198-206

    Abstract

    Recent in vivo NMR studies have raised interest in the structural changes of cellular lipids during proliferative activity. We investigated the changes in plasma membrane lipid and total cell lipid during mitogenically-stimulated proliferation of human peripheral blood lymphocytes by extraction of lipids and assay by 500 MHz 1H-NMR. Resonances were assigned using one- and two-dimensional spectroscopic techniques, and signals unique to certain species of lipid were identified. Choline and ethanolamine-containing lipids, glycerophospholipid backbones, sphingolipids, cholesterol, plasmalogens and triacylglycerols were readily detected. Resolution of a number of lipid species was not possible, despite the use of high-resolution techniques. NMR values for proliferation-induced changes in the most easily determined parameters, namely the total cholesterol to total phospholipid molar ratio, and phosphatidylcholine, phosphatidylethanolamine and sphingolipid composition, were found to agree with traditional methods. Differences in phospholipid and fatty acid profiles were found between plasma membranes and total cell lipid for resting values and for response to mitogen.

    View details for Web of Science ID A1990DZ01600008

    View details for PubMedID 2400782

  • DETERMINATION OF METABOLITE AND NUCLEOTIDE CONCENTRATIONS IN PROLIFERATING LYMPHOCYTES BY H-1-NMR OF ACID-EXTRACTS BIOCHIMICA ET BIOPHYSICA ACTA Sze, D. Y., Jardetzky, O. 1990; 1054 (2): 181-197

    Abstract

    Nuclear magnetic resonance (NMR) studies of extracts have proven to be a powerful window onto the intracellular machinery of cells and tissues. The major advantages of in vitro 1H-NMR, namely chemical preservation, simultaneous detection, identification, and quantitation of compounds, and sensitivity to a large variety of classes of compounds, are employed in this study to characterize the metabolic course of mitogen-stimulated proliferation of human peripheral lymphocytes. A reliable method to quantitate amino acids, metabolic intermediates, soluble membrane lipid precursors, and purine, pyridine and pyrimidine nucleotides is presented, using samples as small as 30 mg wet weight. A total of 53 substances were detected in lymphocytes and other blood cells. During the course of lymphocyte culture, changes in intracellular concentrations of lactate, taurine, inositol and nucleotides, including NAD, IMP and high-energy phosphates, were especially marked. 1H-NMR compares favorably to 31P-NMR and to HPLC, and is especially attractive in light of expectations for future in vivo application.

    View details for Web of Science ID A1990DZ01600007

    View details for PubMedID 2119233

  • SEQUENCE-SPECIFIC H-1-NMR ASSIGNMENTS AND SECONDARY STRUCTURE IN SOLUTION OF ESCHERICHIA-COLI TRP REPRESSOR BIOCHEMISTRY Arrowsmith, C. H., Pachter, R., Altman, R. B., Iyer, S. B., Jardetzky, O. 1990; 29 (27): 6332-6341

    Abstract

    Sequence-specific 1H NMR assignments are reported for the active L-tryptophan-bound form of Escherichia coli trp repressor. The repressor is a symmetric dimer of 107 residues per monomer; thus at 25 kDa, this is the largest protein for which such detailed sequence-specific assignments have been made. At this molecular mass the broad line widths of the NMR resonances preclude the use of assignment methods based on 1H-1H scalar coupling. Our assignment strategy centers on two-dimensional nuclear Overhauser spectroscopy (NOESY) of a series of selectively deuterated repressor analogues. A new methodology was developed for analysis of the spectra on the basis of the effects of selective deuteration on cross-peak intensities in the NOESY spectra. A total of 90% of the backbone amide protons have been assigned, and 70% of the alpha and side-chain proton resonances are assigned. The local secondary structure was calculated from sequential and medium-range backbone NOEs with the double-iterated Kalman filter method [Altman, R. B., & Jardetzky, O. (1989) Methods Enzymol. 177, 218-246]. The secondary structure agrees with that of the crystal structure [Schevitz, R., Otwinowski, Z., Joachimiak, A., Lawson, C. L., & Sigler, P. B. (1985) Nature 317, 782], except that the solution state is somewhat more disordered in the DNA binding region and in the N-terminal region of the first alpha-helix. Since the repressor is a symmetric dimer, long-range intersubunit NOEs were distinguished from intrasubunit interactions by formation of heterodimers between two appropriate selectively deuterated proteins and comparison of the resulting NOESY spectrum with that of each selectively deuterated homodimer. Thus, from spectra of three heterodimers, long-range NOEs between eight pairs of residues were identified as intersubunit NOEs, and two additional long-range intrasubunits NOEs were assigned.

    View details for Web of Science ID A1990DN23200002

    View details for PubMedID 2207078

  • INHIBITION OF LYMPHOCYTE STIMULATION BY SHIFT-REAGENTS MAGNETIC RESONANCE IN MEDICINE Sze, D. Y., CORBELLETTA, N. L., Shochat, S. J., Jardetzky, O. 1990; 13 (1): 14-24

    Abstract

    Lanthanide shift reagents have opened a new avenue in the study of membrane biochemistry, but their stabilities and biological reactivities remain questionable. We present evidence that shift reagents are not biologically inert, and that they exhibit the ability to inhibit stimulation of human peripheral lymphocytes at commonly used concentrations. A survey of various mitogens yielded no shift reagent-resistant modes of stimulation, and a survey of various shift reagents yielded no effective and nontoxic alternatives. Involvement of calcium-regulating mechanisms was not apparent. The assumption that lanthanide shift reagents used in NMR studies are nondestructive and physiologically innocuous is thus shown to be unwarranted.

    View details for Web of Science ID A1990CJ68300003

    View details for PubMedID 2138693

  • NMR ASSIGNMENTS FOR THE AMINO-TERMINAL RESIDUES OF TRP REPRESSOR AND THEIR ROLE IN DNA-BINDING BIOCHEMISTRY Arrowsmith, C. H., Carey, J., TREATCLEMONS, L., Jardetzky, O. 1989; 28 (9): 3875-3879

    Abstract

    The trp repressor of Escherichia coli specifically binds to operator DNAs in three operons involved in tryptophan metabolism. The NMR spectra of repressor and a chymotryptic fragment lacking the six amino-terminal residues are compared. Two-dimensional J-correlated spectra of the two forms of the protein are superimposable except for cross-peaks that are associated with the N-terminal region. The chemical shifts and relaxation behavior of the N-terminal resonances suggest mobile "arms". Spin-echo experiments on a ternary complex of repressor with L-tryptophan and operator DNA indicate that the termini are also disordered in the complex, although removal of the arms reduces the DNA binding energy. Relaxation measurements on the armless protein show increased mobility for several residues, probably due to helix fraying in the newly exposed N-terminal region. DNA binding by the armless protein does not reduce the mobility of these residues. Thus, it appears that the arms serve to stabilize the N-terminal helix but that this structural role does not explain their contribution to the DNA binding energy. These results suggest that the promiscuous DNA binding by the arms seen in the X-ray crystal structure is found in solution as well.

    View details for Web of Science ID A1989U467600037

    View details for PubMedID 2665811

  • H-1-NMR SPECTROSCOPY - AN APPROACH TO EVALUATION OF DISEASED SKIN INVIVO JOURNAL OF INVESTIGATIVE DERMATOLOGY Kim, Y. H., Orenberg, E. K., Faull, K. F., WADEJARDETZKY, N. G., Jardetzky, O. 1989; 92 (2): 210-216

    Abstract

    1H nuclear magnetic resonance (NMR) spectroscopy was tested for its applicability in evaluating diseased skin. In order to explore potential spectral markers characteristic of diseased tissue, perchloric acid (PCA) extracts of psoriasis and malignant melanoma tissues were compared with normal skin, and changes in melanoma after heat treatment were monitored. In psoriatic plaque extract, the spectral peak intensity ratios of Glu: Ser, creatine: Gly, and taurine: Ala were approximately three-fold compared with symptom-free or normal skin, whereas Val: Leu/Ile was one-half the normal skin ratio. In melanoma extracts, the phosphorylcholine (PC)/glycerophosphorylcholine (GPC): Ala, Glu: Ser, and lactate: Ala ratios were five-, three-, and two-fold higher, respectively, than normal skin and the Val: Leu/Ile ratio was two-thirds of normal skin. With heat treatment, PC/GPC: Ala and Glu: Ser ratios decreased, whereas lactate: Ala and Val: Leu/Ile ratios increased three-fold and one-third, respectively. Results indicate that 1H NMR spectroscopy is a sufficiently sensitive technique to distinguish normal from diseased skin. The main attraction of this technique lies in the possibility of non-invasive study of various skin diseases, malignant transformation of benign tumors, and responses to treatment. Several methodologic problems remain to be resolved before a meaningful interpretation of in vivo observations becomes feasible. Correlation of in vivo and in vitro findings is an essential step toward this goal.

    View details for Web of Science ID A1989T322300012

    View details for PubMedID 2537364

  • The structure of proteins and their binding sites: NMR and artificial intelligence. Progress in clinical and biological research Jardetzky, O., Lichtarge, O., Brinkley, J., Madrid, M. 1989; 289: 145-156

    View details for PubMedID 2726796

  • HEURISTIC REFINEMENT METHOD FOR THE DERIVATION OF PROTEIN SOLUTION STRUCTURES - VALIDATION ON CYTOCHROME B-562 JOURNAL OF CHEMICAL INFORMATION AND COMPUTER SCIENCES Brinkley, J. F., Altman, R. B., Duncan, B. S., Buchanan, B. G., Jardetzky, O. 1988; 28 (4): 194-210

    Abstract

    A method is described for determining the family of protein structures compatible with solution data obtained primarily from nuclear magnetic resonance (NMR) spectroscopy. Starting with all possible conformations, the method systematically excludes conformations until the remaining structures are only those compatible with the data. The apparent computational intractability of this approach is reduced by assembling the protein in pieces, by considering the protein at several levels of abstraction, by utilizing constraint satisfaction methods to consider only a few atoms at a time, and by utilizing artificial intelligence methods of heuristic control to decide which actions will exclude the most conformations. Example results are presented for simulated NMR data from the known crystal structure of cytochrome b562 (103 residues). For 10 sample backbones an average root-mean-square deviation from the crystal of 4.1 A was found for all alpha-carbon atoms and 2.8 A for helix alpha-carbons alone. The 10 backbones define the family of all structures compatible with the data and provide nearly correct starting structures for adjustment by any of the current structure determination methods.

    View details for Web of Science ID A1988R230100006

    View details for PubMedID 3235473

  • COMPARISON OF INTRACELLULAR PH MEASUREMENTS BY P-31 NMR AND WEAK ACID PARTITIONING IN CHINESE-HAMSTER OVARY FIBROBLASTS MAGNETIC RESONANCE IN MEDICINE GONZALEZMENDEZ, R., Hahn, G. M., WADEJARDETZKY, N. G., Jardetzky, O. 1988; 6 (4): 373-380

    Abstract

    Intracellular pH measurements obtained by 31P NMR and DMO partitioning are compared. A continuous-flow culture system was used to measure the intracellular pH of Chinese hamster ovary fibroblasts in response to changes in the extracellular pH. These measurements were repeated with the CHO cells in suspension and under similar experimental conditions using the weak acid partitioning technique employing 14C-DMO. It is shown that the pHi values are identical, within experimental error, for both techniques in the 6.80-7.70 pH range, with the DMO technique giving slightly more acidic intracellular pH in the 6.00-6.80 range. It is concluded that both techniques give similar values for intracellular pH in the physiological range, with the DMO partitioning giving more acidic values at pH's less than 6.80. The range of validity for pHi measurements using 31P NMR lies between 6.70 and 7.50.

    View details for Web of Science ID A1988M928200001

    View details for PubMedID 3379999

  • COMPARISON OF EXPERIMENTALLY DETERMINED PROTEIN STRUCTURES BY SOLUTION OF BLOCH EQUATIONS BIOCHIMICA ET BIOPHYSICA ACTA Madrid, M., Jardetzky, O. 1988; 953 (1): 61-69

    Abstract

    Nuclear Overhauser enhancement (NOESY) spectra were theoretically generated by solving the generalized Bloch equations with the appropriate initial conditions. The input to the equations were the coordinates of the protons of two similar crystal structures of basic pancreatic trypsin inhibitor. The two NOESY spectra obtained were compared to published experimental spectra of the protein in solution. It was found that the two crystal structures of basic pancreatic trypsin inhibitor give different theoretical spectra. The solution of the Bloch equations is very sensitive to small variations in the distance between protons (approx. 0.2 A), and to differences in the surrounding configurations. The method allows a detailed comparison of the crystal and solution structures of proteins. The structure of the trypsin inhibitor in solution was found to be similar to either one or the other crystal forms in different regions of the molecule.

    View details for Web of Science ID A1988M496300008

    View details for PubMedID 2449246

  • A DESCRIPTION OF CONFORMATIONAL TRANSITIONS IN THE PRIBNOW BOX OF THE TRP PROMOTER OF ESCHERICHIA-COLI BIOCHEMISTRY Lefevre, J. F., Lane, A. N., Jardetzky, O. 1988; 27 (4): 1086-1094

    Abstract

    Selective changes in the NMR parameters of the sequence of CGTACTAGTTAACTAGTACG, which corresponds to the trp operator of Escherichia coli, were observed as a function of temperature. The changes were localized to the sequence TTAA in the Pribnow box (underlined). Differential changes in chemical shift were analyzed in terms of a three-state model (states I, II, and III) to give the equilibrium constants, enthalpy changes, and populations. The midpoints of the first and second transitions were 9 and 30 degrees C, with enthalpy changes of 58 and 35 kcal/mol, respectively. Measurement of the spin-lattice and cross-relaxation rate constants at different temperatures allowed some structural conclusions to be drawn about the nature of the transitions. The line width of the H2 of A11 goes through a maximum at about 30 degrees C, indicating moderately fast exchange between the states. The rate constants for exchange at the midpoints were about 200 (I----II) and 250 (II----III) s-1. Taking these findings into account, we propose a mechanism for the interaction between RNA polymerase and the promoter. This mechanism can explain the temperature dependence observed for the initiation of transcription.

    View details for Web of Science ID A1988M255100002

    View details for PubMedID 3284577

  • SECONDARY STRUCTURE DETERMINATION OF HUMAN BETA-ENDORPHIN BY H-1-NMR SPECTROSCOPY BIOCHEMISTRY Lichtarge, O., Jardetzky, O., Li, C. H. 1987; 26 (18): 5916-5925

    Abstract

    The 1H NMR spectra of human beta-endorphin indicate that the peptide exists in random-coil form in aqueous solution but becomes helical in mixed solvent. Thermal denaturation NMR experiments show that in water there is no transition between 24 and 75 degrees C, while a slow noncooperative thermal unfolding is observed in a 60% methanol-40% water mixed solvent in the same temperature range. These findings are consistent with circular dichroism studies by other workers concluding that beta-endorphin is a random coil in water but that it forms 50% alpha-helix or more in mixed solvents. The peptide in the mixed water-methanol solvent was further studied by correlated spectroscopy (COSY) and nuclear Overhauser effect spectroscopy (NOESY) experiments. These allow a complete set of assignments to be made and establish two distinct stretches over which the solvent induces formation of alpha-helices: the first occurs between Tyr-1 and Thr-12 and the second between Leu-14 and extending to Lys-28. There is evidence that the latter is capped by a turn occurring between Lys-28 and Glu-31. These helices form at the enkephalin receptor binding site, which is at the amino terminus, and at the morphine receptor binding site, located at the carboxyl terminus [Li, C. H. (1982) Cell (Cambridge, Mass.) 31, 504-505]. Our findings suggest that these two receptors may specifically recognize alpha-helices.

    View details for Web of Science ID A1987K057900051

    View details for PubMedID 2960378

  • SOLUTION STRUCTURE OF THE TRP OPERATOR OF ESCHERICHIA-COLI DETERMINED BY NMR BIOCHEMISTRY Lefevre, J. F., Lane, A. N., Jardetzky, O. 1987; 26 (16): 5076-5090

    Abstract

    We have assigned the majority of the nonexchangeable protons in the NMR spectrum of the 20 base-pair fragment of DNA corresponding to the Trp operator of Escherichia coli. The sequence (CGTACTAGTTAACTAGTACG) also contains a Pribnow box (underlined). Variation of the intrinsic spin-lattice relaxation rate constants of the H8's along the sequence indicates that the structure of the oligonucleotide is not regular. Splitting patterns of the H1' resonances in the deoxyriboses, obtained from a two-dimensional J-resolved experiment, allowed the dominant pucker mode of each nucleotide to be determined. Intranucleotide NOEs from the sugar protons H1', H2', and H3' to the base protons were used to determine the conformation of each nucleotide (puckers and glycosidic torsion angles). The relative orientations of nucleotide units (roll, propeller twist, helical twist angle, and pitch) were calculated by using internucleotide NOEs between protons of neighboring nucleotides in the sequence. All these parameters were determined for each step along the 20-mer. The structure belongs to the B family of conformations, but variations of the local geometry are observed from step to step. Some of the variations, such as the roll and the twist angles, can be predicted by the rules of Calladine and Dickerson [Calladine, C. R., & Dickerson, R. E. (1983) J. Mol. Biol. 166, 419-441]. The puckers of the deoxyriboses of purines are found mainly in conformations near C2' endo, while those of the pyrimidines prefer C3' endo and related conformations. Glycosidic torsion angles obtained for purines are larger than those of pyrimidines. Except for this last observation, the general properties of the operator DNA structure are comparable with those of crystal structures of B DNA of other sequences.

    View details for Web of Science ID A1987J557100029

    View details for PubMedID 3311161

  • VALIDATION OF THE 1ST STEP OF THE HEURISTIC REFINEMENT METHOD FOR THE DERIVATION OF SOLUTION STRUCTURES OF PROTEINS FROM NMR DATA PROTEINS-STRUCTURE FUNCTION AND GENETICS Lichtarge, O., Cornelius, C. W., Buchanan, B. G., Jardetzky, O. 1987; 2 (4): 340-358

    Abstract

    A new method for the analysis of NMR data in terms of the solution structure of proteins has been developed. The method consists of two steps: first a systematic search of the conformational space to define the region allowed by the initial set of experimental constraints, and second, the narrowing of this region by the introduction of additional constraints and optional refinement procedures. The search of the conformational space is guided by heuristics to make it computationally feasible. The method is therefore called the heuristic refinement method and is coded in an expert system called PROTEAN. The paper describes the validation of the first step of the method using an artificial NMR data set generated from the known crystal structure of sperm whale carbon monoxymyoglobin. It is shown that the initial search procedure yields a low-resolution structure of the myoglobin molecule, accurately reproducing its main topological features, and that the precision of the structure depends on the quality of the initial data set.

    View details for Web of Science ID A1987L693800008

    View details for PubMedID 3448608

  • MEASUREMENT OF MITOCHONDRIAL ATPASE ACTIVITY IN MAIZE ROOT-TIPS BY SATURATION TRANSFER P-31 NUCLEAR MAGNETIC-RESONANCE PLANT PHYSIOLOGY Roberts, J. K., Wemmer, D., Jardetzky, O. 1984; 74 (3): 632-639

    Abstract

    We show that saturation transfer (31)P nuclear magnetic resonance can be used to measure the activity of the mitochondrial ATPase of maize (Zea mays L. hybrid WW x Br38) root tips in vivo. Unidirectional rates of ATP synthesis were determined in the steady state (i.e. ATP and cytoplasmic orthophosphate constant) under various conditions. These measurements, and determinations of oxygen consumption, give a P/O ratio (measured in the living tissue) close to 3. In succinate-fed root tips the P/O ratio is approximately 2. Cyanide inhibits the rate of ATP synthesis by two-thirds (P/O ratio approximately 1), with an effective inhibitor constant of approximately 35 micromolars. We show that the alternative electron pathway cannot make ATP, and does not normally operate in this tissue. This method of studying plant mitochondrial metabolism avoids potential artifacts encountered in studies using isolated and purified mitochondria. The method also allows, for the first time, direct and simultaneous examination of the relationship between the rate of ATP synthesis and levels of metabolites such as ATP, and derived parameters such as phosphorylation potential.

    View details for Web of Science ID A1984SJ10800031

    View details for PubMedID 16663473

  • SALT STIMULATION OF PHOSPHATE-UPTAKE IN MAIZE ROOT-TIPS STUDIED BY P-31 NUCLEAR MAGNETIC-RESONANCE PLANT PHYSIOLOGY Roberts, J. K., LINKER, C. S., Benoit, A. G., Jardetzky, O., NIEMAN, R. H. 1984; 75 (4): 947-950

    Abstract

    The effects of external salt and inorganic phosphate (Pi) on the concentrations of vacuolar Pi, and cytoplasmic Pi, ATP, glucose-6-phosphate and UDP-glucose in maize root tips were examined using (31)P nuclear magnetic resonance spectroscopy. We observed a more than two-fold stimulation of Pi uptake from 10 millimolar KH(2)PO(4) solutions when root tips were exposed to 100 millimolar NaCl + CaCl(2). This stimulation of Pi uptake was associated with an increase in the concentration of cytoplasmic Pi in root tip cells. Thus, the molar ratio of cytoplasmic Pi to Pi + ATP + glucose-6-phosphate + UDP-glucose increased greatly in root tips exposed to salt and Pi. We speculate that it is this disturbance in relative concentrations of cytoplasmic phosphates (which we show are normally tightly regulated) that is responsible for both the greater rate of uptake of Pi by vacuoles of excised maize root tips, and the previously documented stimulation of Pi translocation from root to shoot in whole maize plants exposed to salt and Pi.

    View details for Web of Science ID A1984TG59600013

    View details for PubMedID 16663765

  • CONTINUOUS-FLOW NMR CULTURE SYSTEM FOR MAMMALIAN-CELLS BIOCHIMICA ET BIOPHYSICA ACTA GONZALEZMENDEZ, R., Wemmer, D., Hahn, G., WADEJARDETZKY, N., Jardetzky, O. 1982; 720 (3): 274-280

    Abstract

    A continuous-flow NMR culture system for mammalian cells has been developed on which 31P-NMR experiments under complete and strictly physiologic conditions have been performed. Observations on the response of the cellular metabolism to stresses such as starvation, low temperature and changes in environmental pH monitored by 31P-NMR are reported. The response of the intracellular pH relative to the external pH of the growth medium is studied. We find that under the experimental conditions used there exists a delta pH varying between less than 0.2 and more than 0.6 pH units. These results are compatible with those obtained using other techniques.

    View details for Web of Science ID A1982NU65100007

    View details for PubMedID 7104397

  • REGULATION OF CYTOPLASMIC AND VACUOLAR PH IN MAIZE ROOT-TIPS UNDER DIFFERENT EXPERIMENTAL CONDITIONS PLANT PHYSIOLOGY Roberts, J. K., Wemmer, D., Ray, P. M., Jardetzky, O. 1982; 69 (6): 1344-1347

    Abstract

    (31)P-Nuclear magnetic resonance spectra of perfused maize (Zea mays L., hybrid WW x Br 38) root tips, obtained at 10-minute intervals over 12 hours or longer, indicate that no cytoplasmic or vacuolar pH changes occur in these cells in the presence of 25 millimolar K(2)SO(4), which induces extrusion of 4 to 5 microequivalents H(+) per gram per hour. In contrast, hypoxia causes cytoplasmic acidification (0.3-0.6 pH unit) without a detectable change in vacuolar pH. The cytoplasm quickly returns to its original pH on reoxygenation. Dilute NH(4)OH increases the vacuolar pH more than it does the cytoplasmic pH; after NH(4)OH is removed, the vacuole recovers its original pH more slowly than does the cytoplasm. The results indicate that regulation of cytoplasmic pH and that of vacuolar pH in plant cells are separate processes.

    View details for Web of Science ID A1982NV81600020

    View details for PubMedID 16662399

  • COMPARISON OF PROTEIN STRUCTURES BY HIGH-RESOLUTION SOLID-STATE AND SOLUTION NMR FEBS LETTERS Jardetzky, O., WADEJARDETZKY, N. G. 1980; 110 (1): 133-135

    View details for Web of Science ID A1980JC15200033

    View details for PubMedID 7353658

  • Applications of nuclear magnetic resonance spectroscopy to the study of macromolecules. Annual review of biochemistry Jardetzky, O., Wade-Jardetzky, N. G. 1971; 40: 605-634

    View details for PubMedID 4330581

  • The conformation of pyridine dinucleotides in solution. journal of biological chemistry Jardetzky, O., Wade-Jardetzky, N. G. 1966; 241 (1): 85-91

    View details for PubMedID 4379057

  • On the mechanism of the binding of sulfonamides to bovine serum albumin. Molecular pharmacology Jardetzky, O., Wade-Jardetzky, N. G. 1965; 1 (3): 214-230

    View details for PubMedID 5842823

Stanford Medicine Resources: