Oleg Jardetzky
Publication Details
-
A description of conformational transitions in the Pribnow box of the trp promoter of Escherichia coli.
Biochemistry. 1988; (4): 1086-94
Selective changes in the NMR parameters of the sequence of CGTACTAGTTAACTAGTACG, which corresponds to the trp operator of Escherichia coli, were observed as a function of temperature. The changes were localized to the sequence TTAA in the Pribnow box (underlined). Differential changes in chemical shift were analyzed in terms of a three-state model (states I, II, and III) to give the equilibrium constants, enthalpy changes, and populations. The midpoints of the first and second transitions were 9 and 30 degrees C, with enthalpy changes of 58 and 35 kcal/mol, respectively. Measurement of the spin-lattice and cross-relaxation rate constants at different temperatures allowed some structural conclusions to be drawn about the nature of the transitions. The line width of the H2 of A11 goes through a maximum at about 30 degrees C, indicating moderately fast exchange between the states. The rate constants for exchange at the midpoints were about 200 (I----II) and 250 (II----III) s-1. Taking these findings into account, we propose a mechanism for the interaction between RNA polymerase and the promoter. This mechanism can explain the temperature dependence observed for the initiation of transcription.
